Review



peroxidase vector laboratories mp 7401 immpact dab eqv substrate kit  (Vector Laboratories)


Bioz Verified Symbol Vector Laboratories is a verified supplier
Bioz Manufacturer Symbol Vector Laboratories manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Vector Laboratories peroxidase vector laboratories mp 7401 immpact dab eqv substrate kit
    Peroxidase Vector Laboratories Mp 7401 Immpact Dab Eqv Substrate Kit, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1297 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peroxidase+vector+laboratories+mp+7401+immpact+dab+substrate/ImmPRESS+HRP+Anti-Rabbit+IgG+(Peroxidase)+Polymer+Detection+Kit%2C+made+in+Horse/pm39466775-1361-115-116
    Average 96 stars, based on 1297 article reviews
    peroxidase vector laboratories mp 7401 immpact dab eqv substrate kit - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Single Cell:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Article Title: Single-Cell RNA-Seq Analysis of Human iPSC-Derived Motor Neurons Resolves Early and Predictive ALS Signatures
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr ep rin t n ot p e r r ev ie we d BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLongTM Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStartTM PCR Master Sigma 4710436001 TOPOTM TA CloningTM Kit for Sequencing Sigma K457501 PrimeSTAR® HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT® DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr pr i t n ot p e r r ev ie we d 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALSC9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALSC9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A This preprint research paper has not been peer reviewed.

    Multiplex Assay:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Article Title: Single-Cell RNA-Seq Analysis of Human iPSC-Derived Motor Neurons Resolves Early and Predictive ALS Signatures
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr ep rin t n ot p e r r ev ie we d BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLongTM Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStartTM PCR Master Sigma 4710436001 TOPOTM TA CloningTM Kit for Sequencing Sigma K457501 PrimeSTAR® HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT® DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr pr i t n ot p e r r ev ie we d 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALSC9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALSC9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A This preprint research paper has not been peer reviewed.

    Polymerase Chain Reaction:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Article Title: Single-Cell RNA-Seq Analysis of Human iPSC-Derived Motor Neurons Resolves Early and Predictive ALS Signatures
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr ep rin t n ot p e r r ev ie we d BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLongTM Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStartTM PCR Master Sigma 4710436001 TOPOTM TA CloningTM Kit for Sequencing Sigma K457501 PrimeSTAR® HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT® DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr pr i t n ot p e r r ev ie we d 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALSC9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALSC9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A This preprint research paper has not been peer reviewed.

    TA Cloning:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Sequencing:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Article Title: Single-Cell RNA-Seq Analysis of Human iPSC-Derived Motor Neurons Resolves Early and Predictive ALS Signatures
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr ep rin t n ot p e r r ev ie we d BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLongTM Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStartTM PCR Master Sigma 4710436001 TOPOTM TA CloningTM Kit for Sequencing Sigma K457501 PrimeSTAR® HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT® DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr pr i t n ot p e r r ev ie we d 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALSC9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALSC9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A This preprint research paper has not been peer reviewed.

    Reverse Transcription:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Article Title: Single-Cell RNA-Seq Analysis of Human iPSC-Derived Motor Neurons Resolves Early and Predictive ALS Signatures
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr ep rin t n ot p e r r ev ie we d BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLongTM Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStartTM PCR Master Sigma 4710436001 TOPOTM TA CloningTM Kit for Sequencing Sigma K457501 PrimeSTAR® HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT® DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr pr i t n ot p e r r ev ie we d 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALSC9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALSC9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A This preprint research paper has not been peer reviewed.

    Polymer:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Article Title: Single-Cell RNA-Seq Analysis of Human iPSC-Derived Motor Neurons Resolves Early and Predictive ALS Signatures
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr ep rin t n ot p e r r ev ie we d BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLongTM Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStartTM PCR Master Sigma 4710436001 TOPOTM TA CloningTM Kit for Sequencing Sigma K457501 PrimeSTAR® HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT® DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr pr i t n ot p e r r ev ie we d 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALSC9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALSC9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A This preprint research paper has not been peer reviewed.

    RNA Sequencing:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Article Title: Single-Cell RNA-Seq Analysis of Human iPSC-Derived Motor Neurons Resolves Early and Predictive ALS Signatures
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr ep rin t n ot p e r r ev ie we d BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLongTM Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStartTM PCR Master Sigma 4710436001 TOPOTM TA CloningTM Kit for Sequencing Sigma K457501 PrimeSTAR® HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT® DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr pr i t n ot p e r r ev ie we d 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALSC9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALSC9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A This preprint research paper has not been peer reviewed.

    Gene Expression:

    Article Title: Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease Signatures.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 (Continued on next page) e1 Cell Systems 12, 159–175.e1–e9, February 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLong Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStart PCR Master Sigma 4710436001 TOPO TA Cloning Kit for Sequencing Sigma K457501 PrimeSTAR HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALS-C9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx (Continued on next page) Cell Systems 12, 159–175.e1–e9, February 17, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALS-C9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 Sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 Sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 repeat primed PCR anchor (forward): TACGCATCCCAGTTTGAGACG Sigma N/A C9orf72 repeat primed PCR repeat-plusanchor (forward) TACGCATCCCAGTTTGAGACGGGGGCC GGGGCCGGGGCCGGGG Sigma N/A C9orf72 repeat primed PCR rev-plus6FAM (reverse) 6-FAM-AGTCGCTAGAGGCGAAAGC Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A C9orf72 sense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/CCCCGGCCCCGGCCCC C9orf72 antisense FISH probe Product #500150, Exiqon Inc. Woburn, MA, USA 5TYE563/GGGGCCGGGGCCGGGG Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) plasmids Addgene plasmid # 48138; RRID: Addgene_48138 Software and Algorithms RStudio N/A https://rstudio.com Seurat version 2.3.0 Butler, et al., 2018 https://github.com/satijalab/seurat/ releases/tag/v2.3.0 Monocle 2.12.0 Qiu et al., 2017 http://cole-trapnell-lab.github.io/ monocle-release/docs Illumina bcl2fastq Illumina https://support.illumina.com/ sequencing/sequencing_software/ bcl2fastq-conversion-software.html (Continued on next page) e3 Cell Systems 12, 159–175.e1–e9, February 17, 2021

    Article Title: Single-Cell RNA-Seq Analysis of Human iPSC-Derived Motor Neurons Resolves Early and Predictive ALS Signatures
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal IgG anti-Human ISL1 R&D Systems AF1837; RRID: AB_2126324 Mouse monoclonal IgG1 anti-NF-H (SMI-32) BioLegend 801701; RRID: AB_2564642 Rabbit polyclonal IgG anti-PHOX2B GeneTex GTX109677; RRID: AB_1951223 Rabbit polyclonal IgG anti-Human ELAVL3/HUC (for immunohistochemistry staining) LSBio LS-C408905-50 Rabbit polyclonal IgG anti-CHX10 (VSX2) Novus NBP1-84476; RRID: AB_11022841 Rabbit polyclonal IgG anti-SOX1 [EPR4766] GeneTex GTX62974 Goat polyclonal anti-ChAT Millipore AB144P; RRID: AB_2079751 Rabbit polyclonal Poly(GP) N/A Rb9259 Biological Samples Human lumbar spinal cord tissue sections UC San Diego N/A Chemicals, Peptides, and Recombinant Proteins mTeSR1 StemCell Technologies 85850 DMEM Thermo Fisher Scientific 11995081 IMDM Thermo Fisher Scientific 12440061 F12 Thermo Fisher Scientific 11765062 Neurobasal medium Thermo Fisher Scientific 21103049 B27 (+vitamin A) Thermo Fisher Scientific 17504044 N2 Thermo Fisher Scientific 1780240 NEAA Thermo Fisher Scientific 1114050 GlutaMax Life Tech 35050061 PSA Thermo Fisher Scientific 15240062 D-(+)-Glucose Sigma G7021 Y-27632 dihydrochloride Sigma Y0503 Y-27632 dihydrochloride Tocris 1254 CHIR99021 Xcess Biosciences M60002 LDN193189 Selleck S2618 SB431542 Stemgent 04-0010-10 SB431542 Cayman Chemicals 13031 Dorsomorphin Sigma P5499 SAG Sigma 566660 SAG Cayman Chemicals 11914 Retinoic acid Sigma R2625 All-trans retinoic acid Stemgent 040021 This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr ep rin t n ot p e r r ev ie we d BDNF R&D 248-BDB-005 BDNF Peprotech 45002 EGF Peprotech AF-100-15 FGF2 Peprotech 100-18B GDNF Peprotech 45010 Ascorbic acid Millipore A4403 Compound E Calbiochem 565790 DAPT Cayman Chemicals 13917 Ara-C Sigma C1768 db-cAMP Millipore 28745 Purmorphamine Millipore 540220 Accutase Millipore SCR005 Versene Life Technologies 15040-066 Trypsin-EDTA solution Sigma T4049 Laminin (mouse) Millipore L2020 Poly-ornithine Sigma P4638 Matrigel (growth factor reduced) Corning 354230 Triton X-100 Sigma X100 Tween-20 Sigma P1379 Betaine hydrochloride Millipore B3501-100G Diethyl pyrocarbonate Sigma D5758 ProLongTM Gold Antifade Mountant Thermo Fisher Scientific P36930 Citrisolv Thermo Fisher Scientific 04-355-121 Antigen Unmasking Solution, Tris-Based Vector Laboratories HH-3301 FBS Atlanta Biologicals 511150 Hematoxylin Thermo Fisher Scientific HHS128 Critical Commercial Assays SureCell WTA 3’ Library Prep Kit for the ddSEQ System Illumina 20014280 Chromium Single Cell 3’ Library & Gel Bead Kit v2 10X Genomics PN-120237 Chromium Single Cell A Chip Kit 10X Genomics PN-120236 Chromium i7 Multiplex Kit 10X Genomics PN-120262 FastStartTM PCR Master Sigma 4710436001 TOPOTM TA CloningTM Kit for Sequencing Sigma K457501 PrimeSTAR® HS DNA Polymerase (premix) Takara R040A Papain Dissociation System Worthington LK003150 PureLink RNA Mini Kit Thermo 12183018A Promega Reverse Transcription System Promega A3500 ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase Vector Laboratories MP-7401 ImmPACT® DAB Substrate, Peroxidase (HRP) Vector Laboratories SK-4105 Deposited Data Single cell RNA sequencing data for iPSC-MN cultures This study, Gene Expression Omnibus GSE138121 Experimental Models: Cell Lines 0083_CTR_CTR Cedars-Sinai Biomanufacturing Center CS83iCTR-33nxx This preprint research paper has not been peer reviewed. .. Electronic copy available at: https://ssrn.com/abstract=3586565 Pr pr i t n ot p e r r ev ie we d 0179_CTR_CTR Cedars-Sinai Biomanufacturing Center CS0179iCTR-nxx 0025_CTR_CTR Cedars-Sinai Biomanufacturing Center CS25iCTR-18nxx 0465_CTR_CTR Cedars-Sinai Biomanufacturing Center EDi034-A 0028_C9O_ALS Cedars-Sinai Biomanufacturing Center CS28iALS-C9nxx 0029_C9O_ALS Cedars-Sinai Biomanufacturing Center CS29iALS-C9nxx 0029_ISO_CTR Cedars-Sinai Biomanufacturing Center CS29iALSC9n1.ISOxx 0052_C9O_ALS Cedars-Sinai Biomanufacturing Center CS52iALS-C9nxx 0052_ISO_CTR Cedars-Sinai Biomanufacturing Center CS52iALSC9n6.ISOxx 6ZLD_C9O_ALS Cedars-Sinai Biomanufacturing Center CS6ZLDiALS-nxx 2XWC_SPO_ALS Cedars-Sinai Biomanufacturing Center CS2XWCiALS-nxx 8BRM_SPO_ALS Cedars-Sinai Biomanufacturing Center CS8BRMiALS-nxx Oligonucleotides C9orf72 sanger sequencing primer forward: AAAGAACAGGACAAGTTGCCCCGCC Sigma N/A C9orf72 sanger sequencing primer reverse: GCAGGCACCGCAACCGCAG Sigma N/A C9orf72 total qPCR primer forward: CAGTGATGTCGACTCTTTG Sigma N/A C9orf72 total qPCR primer reverse: AGTAGCTGCTAATAAAGGTGATTTG Sigma N/A C9orf72 TV2 qPCR primer forward: CGGTGGCGAGTGGATATCTC Sigma N/A C9orf72 TV2 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A C9orf72 TV3 qPCR primer forward: GTGTGGGTTTAGGAGATATC Sigma N/A C9orf72 TV3 qPCR primer reverse: TGGGCAAAGAGTCGACATCAC Sigma N/A RPL13A qPCR primer forward: CCTGGAGGAGAAGAGGAAAGAGA Sigma N/A RPL13A qPCR primer reverse: TTGAGGACCTCTGTGTATTTGTCAA Sigma N/A This preprint research paper has not been peer reviewed.



    Similar Products

    peroxidase vector laboratories mp 7401 immpact dab eqv substrate kit  (Vector Laboratories)
    96
    Vector Laboratories peroxidase vector laboratories mp 7401 immpact dab eqv substrate kit
    Peroxidase Vector Laboratories Mp 7401 Immpact Dab Eqv Substrate Kit, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peroxidase+vector+laboratories+mp+7401+immpact+dab+substrate/ImmPRESS+HRP+Anti-Rabbit+IgG+(Peroxidase)+Polymer+Detection+Kit%2C+made+in+Horse/pm39466775-1361-115-116
    Average 96 stars, based on 1 article reviews
    peroxidase vector laboratories mp 7401 immpact dab eqv substrate kit - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    mp 7401 immpact dab hrp substrate vector laboratories  (Vector Laboratories)
    96
    Vector Laboratories mp 7401 immpact dab hrp substrate vector laboratories
    Mp 7401 Immpact Dab Hrp Substrate Vector Laboratories, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peroxidase+vector+laboratories+mp+7401+immpact+dab+substrate/ImmPACT+DAB+Peroxidase+(HRP)+Substrate/pm36925716-123-109-114
    Average 96 stars, based on 1 article reviews
    mp 7401 immpact dab hrp substrate vector laboratories - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    peroxidase vector laboratories mp 7401 immpact dab substrate  (Vector Laboratories)
    96
    Vector Laboratories peroxidase vector laboratories mp 7401 immpact dab substrate
    Peroxidase Vector Laboratories Mp 7401 Immpact Dab Substrate, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peroxidase+vector+laboratories+mp+7401+immpact+dab+substrate/ImmPRESS+HRP+Anti-Rabbit+IgG+(Peroxidase)+Polymer+Detection+Kit%2C+made+in+Horse/pm33382996-283-162-163
    Average 96 stars, based on 1 article reviews
    peroxidase vector laboratories mp 7401 immpact dab substrate - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results